View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3015_high_6 (Length: 235)

Name: NF3015_high_6
Description: NF3015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3015_high_6
NF3015_high_6
[»] chr6 (1 HSPs)
chr6 (16-222)||(3842888-3843094)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 3842888 - 3843094
Alignment:
16 ggaatagccaggaaatggaggagcggcttgaccagaaggaaaagtaccaggtgctgataaataactttgtgaaacttcctgctggtttggatcccatgat 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||    
3842888 ggaatagccaggaaatggaggagcggcttgaccagaaggaaaagtaccgggtgctgataaataactttgtgtaacttcctgctggtttggatcccatgat 3842987  T
116 ggcatttgtccctgtgaaccagaatacatagtcgcagcttgagtggtctgccatgcaggagcttgagctgcatggagactaggatctagcactgtatagt 215  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3842988 ggcatttgtcccattgaaccagaatacatagtcgcagcttgagtggtctgccatgcaggagcttgagctgcatggagactaggatctagcactgtatagt 3843087  T
216 ctctgct 222  Q
    |||||||    
3843088 ctctgct 3843094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University