View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3015_high_7 (Length: 235)
Name: NF3015_high_7
Description: NF3015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3015_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 217
Target Start/End: Complemental strand, 21447153 - 21446941
Alignment:
| Q |
5 |
gagagagattcaatagacttttgtgtttaactttagacaaaaatgtgtcagcggctatatgtgtaggcacaagtgggggcaatggtggtggttggaggtg |
104 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447153 |
gagagagattcaatagacttatgcatttaactttagacaaaaatgtgtcagcggctatatgtgtaggcacaagtgggggcaatggtggtggttggaggtg |
21447054 |
T |
 |
| Q |
105 |
gaaacatacatactctttttgtgggagaagaaaaattgatgggagagtgtagtagcttgttacataatgtttctttggagactagtgttcttgacaagtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447053 |
gaaacatacatactctttttgtgggagaagaaaaattgatgggagagtgtagtagcttgttacataatgtttctttggagactagtgttcttgacaagtg |
21446954 |
T |
 |
| Q |
205 |
gatatggagtttt |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21446953 |
gatatggagtttt |
21446941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University