View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3015_low_7 (Length: 235)
Name: NF3015_low_7
Description: NF3015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3015_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 3842888 - 3843094
Alignment:
| Q |
16 |
ggaatagccaggaaatggaggagcggcttgaccagaaggaaaagtaccaggtgctgataaataactttgtgaaacttcctgctggtttggatcccatgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3842888 |
ggaatagccaggaaatggaggagcggcttgaccagaaggaaaagtaccgggtgctgataaataactttgtgtaacttcctgctggtttggatcccatgat |
3842987 |
T |
|
| Q |
116 |
ggcatttgtccctgtgaaccagaatacatagtcgcagcttgagtggtctgccatgcaggagcttgagctgcatggagactaggatctagcactgtatagt |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3842988 |
ggcatttgtcccattgaaccagaatacatagtcgcagcttgagtggtctgccatgcaggagcttgagctgcatggagactaggatctagcactgtatagt |
3843087 |
T |
|
| Q |
216 |
ctctgct |
222 |
Q |
| |
|
||||||| |
|
|
| T |
3843088 |
ctctgct |
3843094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University