View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3016_high_9 (Length: 350)
Name: NF3016_high_9
Description: NF3016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3016_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 335
Target Start/End: Original strand, 42218646 - 42218951
Alignment:
| Q |
17 |
atcttctgcttcatacaacaaacattcaattttgtaaataaaaatttgaatcactgcgagagggaacttttttcataatctgaacccccaaatcagacgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42218646 |
atcttctgcttcatacaacaaacattcaattttgtaaataaaaatttgaatcactgcgagatggaacttttttcataatctgaacccccaaatcagacgg |
42218745 |
T |
 |
| Q |
117 |
taggaatcaatggatgattataccttgtatgcaattttaatatgaattcttattctaataatatcttttgtgctttgatgaccctactccctaaatgcaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42218746 |
taggaatcaatggatgattataccttgtatgcaattttaatgtgaattcttattctaatagtatcttttgtgctttgatgaccctactccctaaatg--- |
42218842 |
T |
 |
| Q |
217 |
ttttgcaactccattttgcatgtgcctttgctggattagcttactgataagggtttctggtaagtatctttatggaatgcatagttattgtgttctagta |
316 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
42218843 |
----------ctattttgcatatgcctttgctggattagcttactgataagggtttctggtaagtatctttatggaatgcataattattgggttctagta |
42218932 |
T |
 |
| Q |
317 |
tagttcaatttcccctttg |
335 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42218933 |
tagttcaatttcccctttg |
42218951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University