View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3016_low_20 (Length: 202)
Name: NF3016_low_20
Description: NF3016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3016_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 32610957 - 32610788
Alignment:
| Q |
18 |
aatataaattttttccttactgacatgaaatgttataaaagtaatggaaaattagttcaaaaagaatgaattcttatggttattcagtttgttatgttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32610957 |
aatataaattttttccttactgacatgaaatgttataaaagtaatggaaaattagttcaaaaagaatgaattcttatggttattcagtttgttatgttcc |
32610858 |
T |
 |
| Q |
118 |
ttattagatatgtcaaaaggacaaacacaacacatttatatacatttaatattgattcaaagtttatgat |
187 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32610857 |
ttattagatatgtcaaagggacaaacacaacacatttatatacatttaatattgattcaaagtttatgat |
32610788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 65 - 159
Target Start/End: Complemental strand, 32573929 - 32573835
Alignment:
| Q |
65 |
aaaattagttcaaaaagaatgaattcttatggttattcagtttgttatgttccttattagatatgtcaaaaggacaaacacaacacatttatata |
159 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| ||| ||||||||||||||||||| |||| |||||| ||| ||||||||||| ||||| |
|
|
| T |
32573929 |
aaaattagtttaaaaataatgaattcttatggttagtcactttgttatgttccttattaagaatgttaaaagggcaagcacaacacattgatata |
32573835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University