View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3017_low_11 (Length: 335)
Name: NF3017_low_11
Description: NF3017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3017_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 22 - 158
Target Start/End: Original strand, 7837051 - 7837187
Alignment:
| Q |
22 |
tcaagttcacacattagtcttcaataacccacctcaaaattcacaccctaaccataatactactactaatctttatccaccaccacatcttgcaccttct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837051 |
tcaagttcacacattagtcttcaataacccacctcaaaattcacaccctaaccataatactactactaatctttatccaccaccacatcttgcaccttct |
7837150 |
T |
 |
| Q |
122 |
tctcaaagacctatcatagatccagatctaacggctg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837151 |
tctcaaagacctatcatagatccagatctaacggctg |
7837187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 228 - 335
Target Start/End: Original strand, 7837257 - 7837364
Alignment:
| Q |
228 |
aaatatgttaccgagaatgtctgagaaaccacgcggcaagcatgggaagccacgtggtagatggatgtggtgaattcatgccaagcggtgaagaaggtac |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837257 |
aaatatgttaccgagaatgtctgagaaaccacgcggcaagcatgggaagccacgtggtagatggatgtggtgaattcatgccaagcggtgaagaaggtac |
7837356 |
T |
 |
| Q |
328 |
cccacaat |
335 |
Q |
| |
|
|||||||| |
|
|
| T |
7837357 |
cccacaat |
7837364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University