View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3017_low_12 (Length: 306)
Name: NF3017_low_12
Description: NF3017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3017_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 142 - 290
Target Start/End: Complemental strand, 4847132 - 4846984
Alignment:
| Q |
142 |
tataaaactaaagttcctaagcaaatggctggaatacttacatagggtttgtggaaatgagatttctcagatgaaaaactagtctacaagcagagcgtgg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4847132 |
tataaaactaaagttcctaagcaaatggctggaatacttacatagggtttgtggaaatgagatttctcagatgaaaaactagtctacaagcagagcgtgg |
4847033 |
T |
|
| Q |
242 |
aaaagttgggtctcttgatatatcaatttgtgcacatgatggttcagat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4847032 |
aaaagttgggtctcttgatatatcaatttgtgcacatgatggttcagat |
4846984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 54 - 119
Target Start/End: Complemental strand, 4847469 - 4847402
Alignment:
| Q |
54 |
aatctgaagagaggttaaaatttgctagccaatcaacaca--cgccttcacaccaagtgtgaataact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4847469 |
aatctgaagagaggttaaaatttgctagccaatcaacacatctgccttcacaccaagtgtgaataact |
4847402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 4847553 - 4847497
Alignment:
| Q |
1 |
atgagtctttgaagctcttcggaaggtgt-ctccatataacaagagatttcaagaat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
4847553 |
atgagtctttgaagctcttcggaaggtgtcctccatataaccagagatttcaagaat |
4847497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University