View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3017_low_18 (Length: 239)

Name: NF3017_low_18
Description: NF3017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3017_low_18
NF3017_low_18
[»] chr1 (1 HSPs)
chr1 (1-223)||(7500087-7500309)
[»] chr6 (4 HSPs)
chr6 (12-153)||(2153292-2153432)
chr6 (37-86)||(2168554-2168603)
chr6 (37-86)||(2180187-2180236)
chr6 (44-85)||(2207430-2207471)
[»] scaffold0254 (1 HSPs)
scaffold0254 (13-86)||(2094-2167)


Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 7500087 - 7500309
Alignment:
1 aaggcgcgccgcttcgtactcgttggctctacgacagaactacttataggagaatggttgaacctttagatattgctcaatactatctcaaatggtggta 100  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
7500087 aaggcgcaccgcttcgtactcgttggctctacgacagaactacttataggagaatggttgaaccttaagatattgctcaatactatctcaaatggtggta 7500186  T
101 aagactatgtgactagagcaagatcaagacactacgaacaattggaggattggttgtgaaggaagcaacaactacagccacaaacaaagtaactagagat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7500187 aagactatgtgactagagcaagatcaagacactacgaacaattggaggattggttgtgaaggaagcaacaactacagccacaaacaaagtaactagagat 7500286  T
201 aaagaacttactcactttgaatg 223  Q
    |||||||||||||||||||||||    
7500287 aaagaacttactcactttgaatg 7500309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 12 - 153
Target Start/End: Original strand, 2153292 - 2153432
Alignment:
12 cttcgtactcgttggctctacgacagaactacttataggagaatggttgaacctttagatattgctcaatactatctcaaatggtggtaaagactatgtg 111  Q
    |||||||| || |||||||| | | |||| ||||| ||||||||||||||||| ||||| || ||||||| ||||||||| |||||||||||||||||||    
2153292 cttcgtacacgctggctctatggcggaacaacttacaggagaatggttgaaccattagaaatagctcaattctatctcaa-tggtggtaaagactatgtg 2153390  T
112 actagagcaagatcaagacactacgaacaattggaggattgg 153  Q
    || | || |||||| || |||||| |||||||||||||||||    
2153391 acaacagaaagatctagtcactacaaacaattggaggattgg 2153432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 37 - 86
Target Start/End: Original strand, 2168554 - 2168603
Alignment:
37 gaactacttataggagaatggttgaacctttagatattgctcaatactat 86  Q
    ||||||| ||||| ||||||||||||||  ||| ||||||||||||||||    
2168554 gaactacatatagaagaatggttgaaccactagctattgctcaatactat 2168603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 37 - 86
Target Start/End: Original strand, 2180187 - 2180236
Alignment:
37 gaactacttataggagaatggttgaacctttagatattgctcaatactat 86  Q
    ||||||| ||||| ||||||||||||||  ||| ||||||||||||||||    
2180187 gaactacatatagaagaatggttgaaccactagctattgctcaatactat 2180236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 85
Target Start/End: Original strand, 2207430 - 2207471
Alignment:
44 ttataggagaatggttgaacctttagatattgctcaatacta 85  Q
    |||||| |||||||||||||| |||| |||||||||||||||    
2207430 ttatagaagaatggttgaaccattagctattgctcaatacta 2207471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 86
Target Start/End: Complemental strand, 2167 - 2094
Alignment:
13 ttcgtactcgttggctctacgacagaactacttataggagaatggttgaacctttagatattgctcaatactat 86  Q
    |||||||||| ||||||| ||   ||||||| ||||| ||||||||||||||  ||| ||||||||||||||||    
2167 ttcgtactcgctggctcttcggtggaactacatatagaagaatggttgaaccactagctattgctcaatactat 2094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University