View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3017_low_19 (Length: 224)
Name: NF3017_low_19
Description: NF3017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3017_low_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 8923755 - 8923538
Alignment:
| Q |
7 |
ctcattatgatggatcactaatatataaattaagaatcatccaacaagagggataaaaaataaaacagcacaatatagccgtctctaatgaatgcatgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8923755 |
ctcattatgatggatcactaatatataaattaagaatcatccaacaagagggataaaaaataaaacagcacaatatagccgtctctaatgaatgcatgaa |
8923656 |
T |
 |
| Q |
107 |
tttgatttgaggtggcccttttgataatatagttgttttg-ttttttccgttaatattttgaagagtttaaagttagtggatcgtcgatttaaatttata |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8923655 |
tttgatttgaggtggccctttt-ataatatagttcttttgtttttttccgttaatattttgaagagtttaaaggtagtggatcgtcgatttaaatttata |
8923557 |
T |
 |
| Q |
206 |
gtaggaagattaactagtt |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8923556 |
gtaggaagattaactagtt |
8923538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University