View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_24 (Length: 362)
Name: NF3018_high_24
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 39825353 - 39825531
Alignment:
| Q |
1 |
tgctaaaagagactcatcatgaataaactcatatcccgaaaaaacatatttgaagtcaaattaagtaaaagagaccgttcttaaaaaaggtaacaggctt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825353 |
tgctaaaagagactgatcatgaataaactcatatcccgaaaaaacatatttgaagtcaaattaagtaaaagagaccgttcttaaaaaaggtaacaggctt |
39825452 |
T |
|
| Q |
101 |
tatcagatatgtactgaaaaacagaaatcattttcatggctacaaaagagaaagatacccttttcttctgaggttagga |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825453 |
tatcagatatgtactgaaaaacagaaatcattttcatggctacaaaagagaaagatacccttttcttctgaggttagga |
39825531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 236 - 356
Target Start/End: Original strand, 39825584 - 39825702
Alignment:
| Q |
236 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtatttgagagttgagattttgtcgtgtatt |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39825584 |
tacctgtaatctgtaaattgtagtattggattttggtggcatgtgaagtagccggccacaaaattgtttgtattt--gagttgagattttgtcgtgtatt |
39825681 |
T |
|
| Q |
336 |
tgattcactctttcatctcac |
356 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39825682 |
tgattcactctttcatctcac |
39825702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University