View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3018_high_26 (Length: 347)

Name: NF3018_high_26
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3018_high_26
NF3018_high_26
[»] chr8 (2 HSPs)
chr8 (12-276)||(45362823-45363087)
chr8 (307-337)||(45363237-45363267)
[»] chr6 (2 HSPs)
chr6 (41-161)||(25040218-25040338)
chr6 (165-247)||(25040700-25040782)


Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 276
Target Start/End: Original strand, 45362823 - 45363087
Alignment:
12 agagaggggaggaaggtggagcaaaaacgatgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaa 111  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45362823 agagaggggaggaaggtggggcaaaaacgatgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaa 45362922  T
112 cacatattcgagcattatcggcctaacttggtcactcatttcattcaggtggaatattgaaatgcctgttatcatagaaaagtctatttccatattgtca 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||     
45362923 cacatattcgagcattatcggcctaacttggtcactcatttcattcaggtggaatattgaaatgcctgttatcatagcaaagtctatttccatattgtcg 45363022  T
212 gatgcagggcttggcatggccatgtacagtcttggttagtattcaatcaaactcaatggtgttta 276  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
45363023 gatgcagggcttggcatggccatgttcagtcttggttagtattcaataaaactcaatggtgttta 45363087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 307 - 337
Target Start/End: Original strand, 45363237 - 45363267
Alignment:
307 tttgctccttttcctttatgattctgttcat 337  Q
    |||||||||||||||||||||||||||||||    
45363237 tttgctccttttcctttatgattctgttcat 45363267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 41 - 161
Target Start/End: Original strand, 25040218 - 25040338
Alignment:
41 atgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaacacatattcgagcattatcggcctaactt 140  Q
    ||||||||||| ||| | ||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| ||||| ||| | || || || ||||    
25040218 atgccaccagctagtgtgatgacaaggcttatattgattatggtttggagaaaacttatcagaaatccaaacacttattctagcttaattggtctcactt 25040317  T
141 ggtcactcatttcattcaggt 161  Q
    ||||  |  ||||||||||||    
25040318 ggtctttggtttcattcaggt 25040338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 165 - 247
Target Start/End: Original strand, 25040700 - 25040782
Alignment:
165 atattgaaatgcctgttatcatagaaaagtctatttccatattgtcagatgcagggcttggcatggccatgtacagtcttggt 247  Q
    |||||||||||||||  || |||| |||||||||||||||  ||||||||||||| ||||||||||| |||| ||||||||||    
25040700 atattgaaatgcctgccattatagcaaagtctatttccattctgtcagatgcaggacttggcatggctatgttcagtcttggt 25040782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University