View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_31 (Length: 322)
Name: NF3018_high_31
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 77 - 309
Target Start/End: Complemental strand, 35317242 - 35317010
Alignment:
| Q |
77 |
tctctttcttcatacacattaggtactatctgaagcaaaacctcaacgtaggttgtgaaagttgaaacaaatagctcgttgattgcaacctattatgcta |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35317242 |
tctctttcttcatacacattaggtactatctgaagcaaaacctcaacgtaggttgtgaaagttgaaacaaatagctcgttgattgcaacctattatgcta |
35317143 |
T |
 |
| Q |
177 |
ttggagcatcgaaaaaacacctctatctttctcacttgcataattccaaacactgagttgtgtctatcttatttatatctttgatacaccacttcaatct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35317142 |
ttggagcatcgaaaaaacacctctatctttctcacttgcataattccaaacactgagttgtgtctatcttatttatatctttgatacaccacttcactct |
35317043 |
T |
 |
| Q |
277 |
gtcaccaatttgcttcactcaatttttcggttc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35317042 |
gtcaccaatttgcttcactcaatttttcggttc |
35317010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 35317331 - 35317263
Alignment:
| Q |
18 |
gttttccccaatcgatccggcgattctttctccaggtgtcgatctttatatctttttactctctttctt |
86 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35317331 |
gtttaccccaatcgatccggcgattctctctccaggtgtcgatctttatatctttttactctctttctt |
35317263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University