View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_36 (Length: 278)
Name: NF3018_high_36
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 40986747 - 40987004
Alignment:
| Q |
1 |
ccaaccattacaaactccagcctcctaccttatacatttgacacttcaaacattagtgtcatatttttcttacagcaagtcttcatattaatattgcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40986747 |
ccaaccattacaaactccagcctcctagcttatacatttgacacttcaaacattagtgtaatatttttcttacagcaagtcttcatattaatattgcaac |
40986846 |
T |
 |
| Q |
101 |
ttgttaaaattcttttacaactataaacatacaacatgacaagtaaaagttgcaacgtttggatgcttattaaagatgaatgtccaaaggttgatgcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40986847 |
ttgttaaaattcttttacaactataaacataca---tgacaagtaaaagttgcaacgtttggatgcttattaaagatgaatgtccaaaggttgatgcttt |
40986943 |
T |
 |
| Q |
201 |
ggtgcagcttattcttgattagaaggaggttggtttgtgtggctgttttggatgacctttt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40986944 |
ggtgcagcttattcttgattagaaggaggttggtttgtgtggctgttttggatgacctttt |
40987004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University