View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_39 (Length: 257)
Name: NF3018_high_39
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 242
Target Start/End: Original strand, 48069881 - 48070114
Alignment:
| Q |
9 |
cacagactagagattctcaaactagtcaaaaaagaacaagaacttgatcaaccattacgaccaaaaaacctttctggtaccatcaaaaagtgtcttaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48069881 |
cacagactagagattctcaaactagtcaaaaaagaacaagaacttgatcaaccattacgaccaaaaaacctttctggtaccatcaaaaagtgtcttaaaa |
48069980 |
T |
 |
| Q |
109 |
aatgcatgagtgtttttcgcgacgatagtgttaagaaaaacatgcctttaccggtggttctacacgaaccgaattggtaccaagggcaaaaatggagagg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48069981 |
aatgcatgagtgtttttcgcgacgatagtgttaagaaaaacatgcctttaccggtggttctacacgaaccgaattggtaccaagggcaaaaatggagagg |
48070080 |
T |
 |
| Q |
209 |
agcattggtcaaggaagagaagcatcagagacct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48070081 |
agcattggtcaaggaagagaagcatcagagacct |
48070114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University