View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_41 (Length: 253)
Name: NF3018_high_41
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 16 - 167
Target Start/End: Complemental strand, 31696954 - 31696803
Alignment:
| Q |
16 |
gtttggcaactggttaatggagtcttttaccatattacctttcgagccaggaatgctcagaaggaatatcaaacttttcaagctacattgtttgctaata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
31696954 |
gtttggcaactggttaatggagtcttttaccatattacctttagagccaggaatgctgagaaggaatgtcaaacttttcaagccacattgtttgctaata |
31696855 |
T |
 |
| Q |
116 |
gattgatgagagaggttgtgggattcagaatgaaagggagcaatacttggta |
167 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31696854 |
gattgatgagagaggttgtggaattcagaatgaaagggagcaatacttggta |
31696803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University