View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3018_high_41 (Length: 253)

Name: NF3018_high_41
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3018_high_41
NF3018_high_41
[»] chr3 (1 HSPs)
chr3 (16-167)||(31696803-31696954)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 16 - 167
Target Start/End: Complemental strand, 31696954 - 31696803
Alignment:
16 gtttggcaactggttaatggagtcttttaccatattacctttcgagccaggaatgctcagaaggaatatcaaacttttcaagctacattgtttgctaata 115  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||    
31696954 gtttggcaactggttaatggagtcttttaccatattacctttagagccaggaatgctgagaaggaatgtcaaacttttcaagccacattgtttgctaata 31696855  T
116 gattgatgagagaggttgtgggattcagaatgaaagggagcaatacttggta 167  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
31696854 gattgatgagagaggttgtggaattcagaatgaaagggagcaatacttggta 31696803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University