View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_42 (Length: 252)
Name: NF3018_high_42
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 53 - 225
Target Start/End: Original strand, 15692522 - 15692689
Alignment:
| Q |
53 |
atcggtttgcaattttaatttggattcgtttggatttgaacacccctatcctctacttccttagagatctaaccttgtacggggcgacaatcttgtttga |
152 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||||||| | ||||||||| | ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
15692522 |
atcggtttacgattttaatttggattggtttggatttgaacatctctatcctctgcatccttcgaaatctaaccttgtacggggcgacaatcttgtttga |
15692621 |
T |
 |
| Q |
153 |
ttattgcattttcttttttgtatataatgccaaacaagagtccttggttaattaagactttcattacgtcata |
225 |
Q |
| |
|
| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15692622 |
taattgca-----ttttttttatataatgccaaacaagagtccttggttaattaagactttcattacgtcata |
15692689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 65 - 102
Target Start/End: Original strand, 32034490 - 32034527
Alignment:
| Q |
65 |
ttttaatttggattcgtttggatttgaacacccctatc |
102 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32034490 |
ttttaatttggataggtttggatttgaacacccctatc |
32034527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 52 - 101
Target Start/End: Original strand, 40247565 - 40247614
Alignment:
| Q |
52 |
aatcggtttgcaattttaatttggattcgtttggatttgaacacccctat |
101 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
40247565 |
aatcagtttgctgttttaatttggattagtttggttttgaacacccctat |
40247614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 5559364 - 5559316
Alignment:
| Q |
52 |
aatcggtttgcaattttaatttggattcgtttggatttgaacaccccta |
100 |
Q |
| |
|
||||| ||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
5559364 |
aatcgatttgcgattttattttggatctgtttggatttgaacaccccta |
5559316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Original strand, 31127387 - 31127435
Alignment:
| Q |
53 |
atcggtttgcaattttaatttggattcgtttggatttgaacacccctat |
101 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
31127387 |
atcggtttgcggttttattttggatcggtttggatttgaacacccctat |
31127435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 13531269 - 13531221
Alignment:
| Q |
53 |
atcggtttgcaattttaatttggattcgtttggatttgaacacccctat |
101 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
13531269 |
atcggtttgcggttttattttggatcggtttggatttgaacacccctat |
13531221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 7700262 - 7700214
Alignment:
| Q |
52 |
aatcggtttgcaattttaatttggattcgtttggatttgaacaccccta |
100 |
Q |
| |
|
||||||||| | |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7700262 |
aatcggtttacgattttattttggatcggtttggatttgaacaccccta |
7700214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 100
Target Start/End: Original strand, 24575292 - 24575340
Alignment:
| Q |
52 |
aatcggtttgcaattttaatttggattcgtttggatttgaacaccccta |
100 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
24575292 |
aatcggtttgcggttttattttggatcggtttggatttgaacaccccta |
24575340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University