View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_high_58 (Length: 235)
Name: NF3018_high_58
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_high_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 26 - 221
Target Start/End: Complemental strand, 37827660 - 37827465
Alignment:
| Q |
26 |
ggaagcgttttgtttagctacgaatttgttagttgaggtgtcttgctagggccatgagtagctgatgcaggggcaattaaagtcgtggaaccccccagat |
125 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827660 |
ggaagcgttttgtttagctatgaatttgttagttgaggtgtcttgctagggccatgagtagctgatgcaggggcaattaaagtcgtggaaccccccagat |
37827561 |
T |
 |
| Q |
126 |
ctgcccaaagtcacatgaatattgataaagatataaaagagttggcccttgtcaattcattgttatctagctaggagtggctgcaatgatatgcct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827560 |
ctgcccaaagtcacatgaatattgataaagatataaaagagttggcccttgtcaattcattgttatctagctaggagtggctgcaatgatatgcct |
37827465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University