View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3018_high_58 (Length: 235)

Name: NF3018_high_58
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3018_high_58
NF3018_high_58
[»] chr2 (1 HSPs)
chr2 (26-221)||(37827465-37827660)


Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 26 - 221
Target Start/End: Complemental strand, 37827660 - 37827465
Alignment:
26 ggaagcgttttgtttagctacgaatttgttagttgaggtgtcttgctagggccatgagtagctgatgcaggggcaattaaagtcgtggaaccccccagat 125  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37827660 ggaagcgttttgtttagctatgaatttgttagttgaggtgtcttgctagggccatgagtagctgatgcaggggcaattaaagtcgtggaaccccccagat 37827561  T
126 ctgcccaaagtcacatgaatattgataaagatataaaagagttggcccttgtcaattcattgttatctagctaggagtggctgcaatgatatgcct 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37827560 ctgcccaaagtcacatgaatattgataaagatataaaagagttggcccttgtcaattcattgttatctagctaggagtggctgcaatgatatgcct 37827465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University