View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_18 (Length: 398)
Name: NF3018_low_18
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 10359908 - 10360123
Alignment:
| Q |
11 |
gatgaaatggtggggtatccaaaataattggaaaagtaggatcaattaannnnnnnggtgcaccactgaaatttaggctataattacgttgcacttatta |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10359908 |
gatgaaatggtggggtatccaaaaaaattggaaaagtatgatcaattaatttttttggtgtaccactgaaatttaggctataattacgttgcacttatta |
10360007 |
T |
|
| Q |
111 |
gaccaaactgatggaatacatgtatggatttgagtcttccatttcaagcaataacgttttccttgctgctgtaacttttgttgaagaccttgcaaaagaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10360008 |
gaccaaactgatggaatacatgtatggatttgagtcttccatttcaagcaataacgttttccttgctgctgtaacttttgttgaagaccttgcaaaagaa |
10360107 |
T |
|
| Q |
211 |
agaggcaatttggtcg |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10360108 |
agaggcaatttggtcg |
10360123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 272 - 307
Target Start/End: Original strand, 10360113 - 10360148
Alignment:
| Q |
272 |
caatttggtcgcaacaagaaatagtatccatgacca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10360113 |
caatttggtcgcaacaagaaatagtatccatgacca |
10360148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University