View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_34 (Length: 310)
Name: NF3018_low_34
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 62 - 286
Target Start/End: Original strand, 1924216 - 1924440
Alignment:
| Q |
62 |
tgttgtgagatctactccgttgcgtgaaatgaagactgacgatctattttccagaatgcagcatttgcagctgttgcttgagcgatttatggcttgtcgt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1924216 |
tgttgtgagatctactccgttgcgtgaaatgaagactgacgatctattttccagaatgcagcatttgcagctgttgcttgagcgatttatggcttgtcgt |
1924315 |
T |
|
| Q |
162 |
ccaacaggtttgtaatgattagaacataaaaagtttggatttagattgtgtgtagtgtgattgcatgcggttaggatcgtatgatcaagattagacaatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1924316 |
ccaacaggtttgtaatgattagaacataaaaagtttggatttagattgtgtgtagtgtgattgcatgcggttaggatcgtatgatcaagattagacaatc |
1924415 |
T |
|
| Q |
262 |
catattttgatacagtttttccttc |
286 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1924416 |
catattttgatacagtttttccttc |
1924440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University