View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_45 (Length: 252)
Name: NF3018_low_45
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_45 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 23 - 252
Target Start/End: Complemental strand, 37224127 - 37223898
Alignment:
| Q |
23 |
cgacaccaacacgttactgatacatgtcactaagttcgatattaccagtttttcaaattattataagtgttgacgtatcaactgtcagtgtcgtgttctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37224127 |
cgacaccaacacgttactgatacatgtcactaagttcgatattaccagtttttcaaattattataagtgttgacgtatcaactgtcagtgtcgtgtcctt |
37224028 |
T |
|
| Q |
123 |
gtctgtgtcacactttttattctgttttgcaatagattatgagcaatggcaagtaccaaagtgtagtacatagagcagctgtgagcaatggagctacaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224027 |
gtctgtgtcacactttttattctgttttgcaatagattatgagcaatggcaagtacaaaagtgtagtacatagagcagctgtgagcaatggagctacaag |
37223928 |
T |
|
| Q |
223 |
aatgtcattagcaaccgttattgcgccatc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37223927 |
aatgtcattagcaaccgttattgcgccatc |
37223898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University