View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_47 (Length: 249)
Name: NF3018_low_47
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_47 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 37828096 - 37827855
Alignment:
| Q |
8 |
ccaagaatatgcaattataccttaaaattgacttactcatttctgatctaaaggacaaaacttgaaagcgataagagccaaaccatgtaggcatgtaggc |
107 |
Q |
| |
|
|||| ||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37828096 |
ccaacaatgtgcaattataccttaaa-ttgatttactcatttctgatctaaaggacaaaacttgaaagcgataagagccaaaccatgtaggcatgtaggc |
37827998 |
T |
|
| Q |
108 |
gactatgaagcctaggttttcctatgcaaaataatatgcataaaattaatgatat-ttttaactgtatgatgataaatcacaatttatttataaaaaagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827997 |
gactatgaagcctaggttttcctatgcataataatatgcataaaattaatgatattttttaactgtatgatgataaatcacaatttatttataaaaaagt |
37827898 |
T |
|
| Q |
207 |
cttatccaaaacaacacatttttgtctacgtaatctataaaga |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827897 |
cttatccaaaacaacacatttttgtctacgtaatctataaaga |
37827855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University