View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_48 (Length: 249)
Name: NF3018_low_48
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 4037079 - 4037318
Alignment:
| Q |
1 |
ttcgatcttgaagaattattagattaattgtcagatcaacaggtgctacacgcatgcttccttttgttaaattcattcgtcatgttgtacttaggcttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4037079 |
ttcgatcttgaagaattattagattaattgtcagatcaacaggtgctacacgcatgcgtccttttattaaattcattcgtcatgttgtacttaggcttat |
4037178 |
T |
 |
| Q |
101 |
aggagtagattgttcactcaatatgcaatttnnnnnnnnncatgtt-ggtcaaaactcacatacgcactcaaaagcgttttgaggagatgacataaatct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4037179 |
aggagtagattgttcactcaatatgcaattt-aaaaaaaacatgttcggtcaaaactcacatacgcactcaaaagcgttttgaggagatgacacaaatct |
4037277 |
T |
 |
| Q |
200 |
tttttaatttaatcaaggttttgaattcgaatttgaccttt |
240 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4037278 |
tttctaatttaatcaaggttttgaattcgaatttgcccttt |
4037318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University