View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_50 (Length: 249)
Name: NF3018_low_50
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 11622803 - 11622587
Alignment:
| Q |
18 |
taatgttcgactttgcatacaaatatagagactattgttttaacttagataaaacctccacaaaactctttaaaaaggtttctttcttccttaataaatt |
117 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11622803 |
taatgttcgactttgctcacaaatgtagagactattgttttatcttagataaaaccttcacaaaactctttaaaaaggtttctttcttccttaataaatt |
11622704 |
T |
 |
| Q |
118 |
actgaattccaaacaacaaaagaaagcattttgttttgtttttgtcctaaggagttattccaagaaattcccttggtaaaagaagggtagaattgtgtgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11622703 |
actgaattccaaacaacaaaagaaagcattttgttttgtttttgtcctaaggagttattccaagaaatgcccttggtaaaagaagggtagaattgtgtgg |
11622604 |
T |
 |
| Q |
218 |
gatttatatattgtagt |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11622603 |
gatttatatattgtagt |
11622587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University