View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_53 (Length: 246)
Name: NF3018_low_53
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 122 - 230
Target Start/End: Complemental strand, 39824994 - 39824886
Alignment:
| Q |
122 |
ctctcattaatcaaatctcttttcaagtttccaccatctaggttgttaatttcttctctagtttctcaatctctctatgacgcaattcacacattcacta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824994 |
ctctcattaatcaaatctcttttcaagtttccaccatctaggttgttaatttcttctgtagtttctcaatctctctatgacgcaattcacacattcacta |
39824895 |
T |
 |
| Q |
222 |
ccttatttg |
230 |
Q |
| |
|
||||||||| |
|
|
| T |
39824894 |
ccttatttg |
39824886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 39825113 - 39825021
Alignment:
| Q |
1 |
atcggtctcatttcgttgtaatataaaggttcactccgtcgacctcaaggttatagcataactgcaaccacaatttaaaaccagggtatcaac |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
39825113 |
atcggtctcatttcgttgtaatataaaggttcactccgtcggcctcaaggtcatagcatatctacaaccgcaatttaaaaccagggtatcaac |
39825021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University