View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_58 (Length: 239)
Name: NF3018_low_58
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_58 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 45317698 - 45317446
Alignment:
| Q |
1 |
catagggaactgattgaaacccttcagtagatttcttcttgtagattcggtaaaatgttggtctgcattcaaatatttattatttatttaatactccaaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45317698 |
cataaggaactgattgaaacccttcagtagatttcttcttgtagattcggtaaaatgttggtctgcattcaaatatttattatttatttaatactccaaa |
45317599 |
T |
|
| Q |
101 |
caagataatt--------------acatacatatacgcaaatcgaatgaatcacttacaatggagcgaggaaggtcatacaagagatgacattgcctata |
186 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45317598 |
caagataatttatggaagataattacatacatatacgcaaatcgaatgaatcacttacaatggagcgaggaaggtcatacaagagatgacattgcctata |
45317499 |
T |
|
| Q |
187 |
gttaaaaataacacatccattagcaacttttattgatttataccttaatttta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45317498 |
gttaaaaataacacatccattagcaacttttattgatttataccttaatttta |
45317446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University