View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_59 (Length: 236)
Name: NF3018_low_59
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_59 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 45316285 - 45316506
Alignment:
| Q |
16 |
tttttaatgttaagaaataagag--agtgtaattaaaggtttggatgcaatcactgaagagttttcccatgagagtttttccactcaagagatgttttgt |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45316285 |
tttttaatgttaagaaataagagagagtgtaattaaaggtttggatgcaatcaccgaagagtttttccatgagagtttttccactcaagagatgttttgt |
45316384 |
T |
 |
| Q |
114 |
ctaatttattatactcttcagtcttcattacccgacaagagcaacagttatcaatagattgttagttaatttatatcatatacatcattcatatannnnn |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45316385 |
ctaatttattatactcttcggtcttcattacccaacaagagcaacagttatcaatagattgttagttaatttatatcatatacatcattcatata-tttt |
45316483 |
T |
 |
| Q |
214 |
nnaaagtaaatttgaaataattt |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45316484 |
ttaaagtaaatttgaaataattt |
45316506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University