View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3018_low_63 (Length: 217)
Name: NF3018_low_63
Description: NF3018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3018_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 201
Target Start/End: Original strand, 17687573 - 17687761
Alignment:
| Q |
12 |
attattctactattctaggctttgggatttatattttggtggtggatcttcaaactagatgtttcacgaatataaacaattgctggtatgagaaacaagc |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
17687573 |
attattctactattctaggctttggggtttatattttggtggtggatcttcaaactggatgtttcacgaatataaacaattgccggtatgagaaacaa-c |
17687671 |
T |
|
| Q |
112 |
aaggctctcaattgttcaagtgtaatgtttgtttaattagtggggctaataatatcctgattattaagttatggtgtccttaacatactt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17687672 |
aaggctctcaattgttcaagtgtaatgtttgtttaattagtggggctaataatatcctgattattaagttatagtgtccttaacatactt |
17687761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University