View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019-Insertion-12 (Length: 327)
Name: NF3019-Insertion-12
Description: NF3019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019-Insertion-12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 8 - 327
Target Start/End: Complemental strand, 29232770 - 29232448
Alignment:
| Q |
8 |
gtaattatgttctggtggctgccatcgtgttgtatgttgttcttgatgttgcacatgcgaatttggtttacttcttgcagcctgccactgatgcagaaat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29232770 |
gtaattatgttctggtggctgccatcgtgttgtatgttgttcttgatgttgcacatgcgaatttggtttacttcttgcagcctgccactgatgcagaaac |
29232671 |
T |
 |
| Q |
108 |
tcctttgccagctgagctgctgtgatgatcaacttcatctccccatcccaaactttatcagttcg--gtcgctataagcaccaaaccatcgttgccatat |
205 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29232670 |
tcctttgccagctgaactgctgtgatgatcaacttcatctccccatcccaaactttatcagttcggtgtcgctataagcaccaaaccatcgttgccatat |
29232571 |
T |
 |
| Q |
206 |
cattactctcatgactttataacctgcacaatatgg-aaaaaatgcattctgcaaaactctcatcaatatggaaaaggtcttgaaatgctattaaaaggt |
304 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29232570 |
cattactctcatgacttgataacctgcacaatatggaaaaaaatgcattctgcaaaactctcagcaatatggaaaaggtcttgaaatggtattaaaaggt |
29232471 |
T |
 |
| Q |
305 |
tgtataaagaaaaattaatattc |
327 |
Q |
| |
|
|||||| |||||| || |||||| |
|
|
| T |
29232470 |
tgtatagagaaaattttatattc |
29232448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University