View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019-Insertion-29 (Length: 135)
Name: NF3019-Insertion-29
Description: NF3019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019-Insertion-29 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 4e-56
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 8670340 - 8670213
Alignment:
| Q |
8 |
aaaactagttaccacagccaaactatraacttattttaacctaaaccaacaaaccaaactataagcttcaatttcttcttatctttgaagatgactagct |
107 |
Q |
| |
|
||||||||||||||| | |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8670340 |
aaaactagttaccactgacaaactataagcttattttaacctaaaccaacaaaccaaactataagcttcaatttcttcttatctttgaagatgactagct |
8670241 |
T |
|
| Q |
108 |
gattcccgtgcttcgttgcgaatcatcc |
135 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
8670240 |
gattcccgtgcttcgctgcgaatcatcc |
8670213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 6e-40
Query Start/End: Original strand, 49 - 135
Target Start/End: Complemental strand, 8649338 - 8649252
Alignment:
| Q |
49 |
taaaccaacaaaccaaactataagcttcaatttcttcttatctttgaagatgactagctgattcccgtgcttcgttgcgaatcatcc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8649338 |
taaaccaacaaaccaaactataagcttcaatttcttcttatctttgaagatgactagctgattcccgtgcttcgctgcgaatcatcc |
8649252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University