View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019-Insertion-6 (Length: 390)
Name: NF3019-Insertion-6
Description: NF3019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019-Insertion-6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 7 - 390
Target Start/End: Complemental strand, 4676896 - 4676513
Alignment:
| Q |
7 |
atctacgacgttacataatccactatggtgaaatggcacaagcaacatacgatgctttcaacacagagaaagcatcaaagtttgcaggtagttgtaggta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676896 |
atctacgacgttacataatccactatggtgaaatggcacaagcaacatacgatgctttcaacacagagaaagcatcaaagtttgcaggtagttgtaggta |
4676797 |
T |
 |
| Q |
107 |
tgcaaagaatgatttcttttctaaagnnnnnnnagaaaatggaaatccttttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676796 |
tgcaaagaatgatttcttttctaaagtttttttagaaaatggaaatccttttaaatattctgtgacaaaatttatttatgcgacttccgaaatcaatgtt |
4676697 |
T |
 |
| Q |
207 |
ccggaagcgtttattataaagtctttatctagagaagcttggagtaaggaatcaaattggattggatttgttgctgtggctaatgatgaagggaaagatg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676696 |
ccggaagcgtttattataaagtctttatctagagaagcttggagtaaggaatcaaattggattggatttgttgctgtggctaatgatgaagggaaagatg |
4676597 |
T |
 |
| Q |
307 |
tgttggggagaagggatattgtgattgcttggagaggaacgattcaaacattggaatgggttaatgatcttcagtttcttttgg |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676596 |
tgttggggagaagggatattgtgattgcttggagaggaacgattcaaacattggaatgggttaatgatcttcagtttcttttgg |
4676513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University