View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019R-Insertion-10 (Length: 142)
Name: NF3019R-Insertion-10
Description: NF3019R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019R-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 9 - 142
Target Start/End: Original strand, 45142235 - 45142368
Alignment:
| Q |
9 |
gttcctactattagaaaggaaagcctcgtaattcttgatcatagtgatgagatcgacctcagtgaggatgtaggattcaaattgatccaaacatcgtgtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142235 |
gttcctactattagaaaggaaagccttgtaattcttgatcatagtgatgagatcgacctcagtgaggatgtaggattcaaattgatccaaacatcgtgtt |
45142334 |
T |
|
| Q |
109 |
ttcatctttactttctgtaatcttttattttgtg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45142335 |
ttcatctttactttctgtaatcttttattttgtg |
45142368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 53 - 104
Target Start/End: Complemental strand, 34530995 - 34530943
Alignment:
| Q |
53 |
tgatgagatcgacctcagtgaggatgtaggattcaaa-ttgatccaaacatcg |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||| |||| |
|
|
| T |
34530995 |
tgatgagatcgacctcaacgaggatgtaggattcaaagttgatccaaatatcg |
34530943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 42 - 77
Target Start/End: Complemental strand, 29361487 - 29361452
Alignment:
| Q |
42 |
cttgatcatagtgatgagatcgacctcagtgaggat |
77 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29361487 |
cttgatcatagtgatgggatcgacctcagtgaggat |
29361452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 42 - 77
Target Start/End: Original strand, 30270623 - 30270658
Alignment:
| Q |
42 |
cttgatcatagtgatgagatcgacctcagtgaggat |
77 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30270623 |
cttgatcatagtgatgggatcgacctcagtgaggat |
30270658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University