View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019R-Insertion-5 (Length: 293)
Name: NF3019R-Insertion-5
Description: NF3019R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019R-Insertion-5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 9 - 293
Target Start/End: Original strand, 43173288 - 43173572
Alignment:
| Q |
9 |
aaccctttataataattgtgccgttgcctttcataaaacaggaggactctgattgggattgctctttgcacctaccactttgggttcccctaacagaaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173288 |
aaccctttataataattgtgccgttacctttcataaaacaggaggactctgattgggattgctctttgcacctaccactttgggttcccctaacagaaaa |
43173387 |
T |
 |
| Q |
109 |
ggcttcaattgaggagcacttagaggaatggacagaacaattgaaagcaagtggggctgacattgcttctctctctgcttccttgaagaaaccattacgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43173388 |
ggcttcaattgaggagcacttagaggaatggacagaacaattgaaagcaagtggggctgacattgcttccctctctgcttccttgaagaaaccattacgt |
43173487 |
T |
 |
| Q |
209 |
cctctatggatttctcagaaaactgtcatatggttaaatgaagtacctcaccatgattcatgggatttcactccaatcatacttg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173488 |
cctctatggatttctcagaaaactgtcatatggttaaatgaagtacctcaccatgattcatgggatttcactccaatcatacttg |
43173572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University