View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019R-Insertion-6 (Length: 289)
Name: NF3019R-Insertion-6
Description: NF3019R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019R-Insertion-6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 42667420 - 42667614
Alignment:
| Q |
9 |
ttatgtctatgcttcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagcagtgttatttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667420 |
ttatgtctatgcttcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagcagtgttatttt |
42667519 |
T |
 |
| Q |
109 |
ttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtccttgatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667520 |
ttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtccttgatg |
42667614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 231 - 289
Target Start/End: Original strand, 42667642 - 42667700
Alignment:
| Q |
231 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667642 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactg |
42667700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University