View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019R-Insertion-7 (Length: 273)
Name: NF3019R-Insertion-7
Description: NF3019R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019R-Insertion-7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 9 - 273
Target Start/End: Complemental strand, 36207274 - 36207009
Alignment:
| Q |
9 |
ctctcagctgcagttacattgttttttgctgggttctacttggaactttcgatatcgatcttttt-ctccggtaaagttcatcttcactgggaaggttct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36207274 |
ctctcagctgcagttacattgttttttgctgggttctacttggaactttcgatatcgatcttttttctccggtaaagttcatcttcactgggaaggttct |
36207175 |
T |
|
| Q |
108 |
ggttattgtgatttatactattttgggtttctattggtcagttctgttctatggctccacctatttgtacttgatcgtttctctcctagagtcccttcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207174 |
ggttattgtgatttatactattttgggtttctattggtcagttctgttctatggctccacctatttgtacttgatcgtttctctcctagagtcccttcaa |
36207075 |
T |
|
| Q |
208 |
tatagtcagcaacacgcccaaaatgaaaagaacaatgataagacagtcactcatgctacaacatca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207074 |
tatagtcagcaacacgcccaaaatgaaaagaacaatgataagacagtcactcatgctacaacatca |
36207009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 220 - 272
Target Start/End: Original strand, 10989228 - 10989280
Alignment:
| Q |
220 |
cacgcccaaaatgaaaagaacaatgataagacagtcactcatgctacaacatc |
272 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
10989228 |
cacgcccaaactgaaaagaacaatgataaggtagtcacttatgctacaacatc |
10989280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University