View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019R-Insertion-9 (Length: 167)
Name: NF3019R-Insertion-9
Description: NF3019R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019R-Insertion-9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 152
Target Start/End: Original strand, 22383027 - 22383171
Alignment:
| Q |
8 |
actgatatcgaagttatggttgcgattccgaatgtcatgttgagcaagattagtaacagtcctatggatgctgattcttgggtttatgagaatgttactg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22383027 |
actgatatcgaagttatggttgcgattccgaatgtcatgttgagcaagattagtaacagtcctatggatgctgattcttgggtttatgagaatgttactg |
22383126 |
T |
 |
| Q |
108 |
cttacttgttcagaggtggtgtcagtatcaagttagttcagtact |
152 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22383127 |
cttacttgttcagaggtggtgtcaatatcaagttagttcagtact |
22383171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University