View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_high_11 (Length: 277)
Name: NF3019_1D_high_11
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 15618611 - 15618731
Alignment:
| Q |
1 |
ggttctgcctacctcacgacacggaggaacgattcttgatgcgcaactcgaagaatggtagggtgtccaaccactacctatctcgtggcatggaggaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15618611 |
ggttctgcctacctcacgacacggaggaacgattcttgacgcgcaactcgaagaatggtagggtgtccaaccactgcctatctcgtggcatggaggaaat |
15618710 |
T |
|
| Q |
101 |
ggattgtgacgtagacaagta |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15618711 |
ggattgtgacgtagacaagta |
15618731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 157 - 277
Target Start/End: Original strand, 15618767 - 15618909
Alignment:
| Q |
157 |
agggctagaggaactataaatacaaggctcgggttttggtgaggggggaaagatgttagtc----------------------ttaagaaagcgtttgtg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15618767 |
agggctagaggaactataaatacaaggctcgggttttggtgaggggggaaagatgttagtcttggagaaccaatagaggatttttaagaaagcgtttgtg |
15618866 |
T |
|
| Q |
235 |
ccttttagggagggattcataggctagaaacacatgagaggtg |
277 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15618867 |
ccttttagggagggattcataagctagaaacacatgagaggtg |
15618909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University