View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_high_15 (Length: 263)
Name: NF3019_1D_high_15
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 9 - 257
Target Start/End: Original strand, 6711280 - 6711520
Alignment:
| Q |
9 |
tggtgttcatatttaatctagcaaccttcaataaaatttagaaaattttcatatttcatatgagtgtccttttatagtttctattaatcaacttgaatgt |
108 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711280 |
tggtgttcatatttaatcaa-----cttcaataaaatttagaaagttttcatatttcatatgagtgtccttttatagtttctattaatcaacttgaatgt |
6711374 |
T |
 |
| Q |
109 |
acaatttttcctgaattaattagtttaaattttgatatgagaccaattgcattatcnnnnnnnnnngggctgcctatcccaagtaaaatctacataattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
6711375 |
acaatttttcctgaattaattagtttaaattttgatatgagaccaattgcatttt---ttttttttgggctgcctatcccaagtaaaatctacataattg |
6711471 |
T |
 |
| Q |
209 |
tttgacttaatttcatatatcgttcatgactttaattgatagatgttat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711472 |
tttgacttaatttcatatatcgttcatgactttaattgatagatgttat |
6711520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University