View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_high_16 (Length: 250)
Name: NF3019_1D_high_16
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 15938707 - 15938471
Alignment:
| Q |
9 |
gatatgaagtgagagaaagatttgaatattttttgttgttggagtgttcatgtcaaagtgaaccgacaatttatgtggtacaaattaaactgaatgctat |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15938707 |
gatatggagtgagagaaagatttgaatattttttgttgttggagtgttcatgtcaaagtgaaccgacaatttatgtggtacaaattaaactgaatgctat |
15938608 |
T |
 |
| Q |
109 |
gtatttgcatttctttcaccttctttcaaaattcataacacacaaactttcgttttcttctaacaattacattatgtcaaagtgcaccgacacaaacaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15938607 |
gtatttgcatttctttcaccttctttcaaaattcataacacacaaactttcgttttcttctaacaattacattatgtcaaagtgcaccgacacaaacaga |
15938508 |
T |
 |
| Q |
209 |
gactaaacatgcttctagtcaaaactcatgtctaatt |
245 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15938507 |
gattaaacatgcttctagtcaaaactcatgtctaatt |
15938471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 245
Target Start/End: Complemental strand, 39821642 - 39821566
Alignment:
| Q |
170 |
aacaattacattatgtcaaagtgcaccgacacaaacagagactaaa-catgcttctagtcaaaactcatgtctaatt |
245 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||| || ||| || |||||||||||||||| |||||||| |||| |
|
|
| T |
39821642 |
aacaatttcatcatgtcaaagtgcacccacacaagcaccgacccaagcatgcttctagtcaaagctcatgtccaatt |
39821566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University