View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_high_22 (Length: 219)
Name: NF3019_1D_high_22
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 12161052 - 12160864
Alignment:
| Q |
20 |
attagcaccaagatatttaaagcatcatagtaagaaatttaattgtacatagcttgatgaattgtacaaacagatttcgaatgggactttagcgagatgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12161052 |
attagcaccaagatatttaaagcatcatagtaagaaatttaattgtacatagcttgatgaattgtacaaacagatttcgaatggggctttagcgagatgt |
12160953 |
T |
 |
| Q |
120 |
ttaagcgaggaagatgtttatgtaaccttggctacatgaaggaatttctggttcacatcaagctggtgataaaaatgacttgggttttg |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12160952 |
ttgagcgaggaagatgtttatgtaaccttagctacatgaaggaatttctggttcacatcaagctggtgataaaaatgacttgggttttg |
12160864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University