View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_high_23 (Length: 206)
Name: NF3019_1D_high_23
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 39 - 181
Target Start/End: Original strand, 31981187 - 31981329
Alignment:
| Q |
39 |
gtaaattgaaatgataaaaatgcatgtaacgtggatggcagttaatgatttgtctcatcatcataaattgatctgctacttcattcatccacgatgattg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31981187 |
gtaaattgaaatgataaaaatgcatgtaacgtggatggcagttaatgatttgtctcatcatcataaattgatctgctacttcattcatccacgatgattg |
31981286 |
T |
|
| Q |
139 |
tttcttgatttggttaattttaacaagtgagtacttgagtata |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31981287 |
tttcttgatttggttaattttaacaagtgagtacttgagtata |
31981329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University