View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_16 (Length: 265)
Name: NF3019_1D_low_16
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 4186454 - 4186227
Alignment:
| Q |
19 |
aaaacaccacatcctttatattcgaagaaccccgtctcggtcagttcggagaagagattctggtaatcacgggacacatcagagacggcgcagtcacaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4186454 |
aaaacaccacatcctttatattcgaagaaccccatctcggtcagttcggagaagagattctggtaatcacgggacacatcagagacggcgcagtcacaga |
4186355 |
T |
|
| Q |
119 |
ggtaacttccggtgaagaaggtgttgaggcggttgtaggcggtgggagggtggaaagcaaggaatgcttcagtaacctcttggccggcaaggctgagtag |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4186354 |
ggtagcttccggtgaagaaggtgttgaggcggttgtaggcggtgggagggtggaaagcaaggaatgcttcagtaacctcttggccggcaaggctgattag |
4186255 |
T |
|
| Q |
219 |
agggaattcgccaccgggatggtggttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4186254 |
agggaattcgccaccgggatggtggttg |
4186227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 246
Target Start/End: Complemental strand, 4195342 - 4195259
Alignment:
| Q |
163 |
ggagggtggaaagcaaggaatgcttcagtaacctcttggccggcaaggctgagtagagggaattcgccaccgggatggtggttg |
246 |
Q |
| |
|
|||||||||||||| |||||||| || || || ||||||||||| ||| |||| ||||| | ||||| ||||||||||||||| |
|
|
| T |
4195342 |
ggagggtggaaagcgaggaatgcatcggtgacatcttggccggcgaggttgaggagaggaagctcgccgccgggatggtggttg |
4195259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University