View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_24 (Length: 234)
Name: NF3019_1D_low_24
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 211
Target Start/End: Complemental strand, 47836955 - 47836750
Alignment:
| Q |
9 |
aacagagatttagatttgagttcatgaggatgattgagaaatagttgtgatgttgcggttaggtctcttccttttcttatggtagctaactcctctagcc |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836955 |
aacagcgatttagatttgagttcatgaggatgattgagaaatagttgtgatgttgcggttaggtctcttccttttcttatggtagctaactcctctagcc |
47836856 |
T |
 |
| Q |
109 |
tttgactgaaaatcacgaacatcacgcaagtaaaacctaacagcaccatcaccaaaagggt---tacttccaccattgatctcttgatcatatgcggcgc |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47836855 |
tttgactggaaatcacgaacatcacgcaagtaaaacctaacagcaccatcaccaaaaggattactacttccaccattgatctcttgatcatatgcggcgc |
47836756 |
T |
 |
| Q |
206 |
ggaggc |
211 |
Q |
| |
|
|||||| |
|
|
| T |
47836755 |
ggaggc |
47836750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 171
Target Start/End: Complemental strand, 35608910 - 35608806
Alignment:
| Q |
67 |
ttaggtctcttccttttcttatggtagctaactcctctagcctttgactgaaaatcacgaacatcacgcaagtaaaacctaacagcaccatcaccaaaag |
166 |
Q |
| |
|
||||| |||||||||||||| | |||||||| ||||||| |||| |||||||||||||| || | || |||| |||||||| || | |||||||| |
|
|
| T |
35608910 |
ttaggcctcttccttttcttttcatagctaacccctctagattttgcttgaaaatcacgaacgtcccttaaataaatcctaacagaacgagaaccaaaag |
35608811 |
T |
 |
| Q |
167 |
ggtta |
171 |
Q |
| |
|
||||| |
|
|
| T |
35608810 |
ggtta |
35608806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University