View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_26 (Length: 227)
Name: NF3019_1D_low_26
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 8259505 - 8259285
Alignment:
| Q |
1 |
gtgcggcatccgcgtcggaaatagctaccatgtggaggaatcccatgcgtaggtgaaagatgccaccatattttttggctaagttggctagaccacggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8259505 |
gtgcggcatccgcgtcggaaatagctaccatgtggaggaatcccatgcgtaggtgaaagatgccaccatattttttggctaagttggctagaccacggtg |
8259406 |
T |
|
| Q |
101 |
ggttaattggtccatcattaacatgttacctataacaggtaaccctattggtcctggtggatatcttggtcttttgaggattcgtgacactaaacccaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8259405 |
ggttaattggtccatcattaacatgttacctataataggtaaccctattggtcctggtggatatcttggtcttttgaggattcgtgacactaaacccaac |
8259306 |
T |
|
| Q |
201 |
aagagtattagtggtacgatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8259305 |
aagagtattagtggtacgatg |
8259285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University