View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_34 (Length: 204)
Name: NF3019_1D_low_34
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 21 - 198
Target Start/End: Complemental strand, 31206511 - 31206336
Alignment:
| Q |
21 |
gaacacatatcttgaatattacaaaccgttttatttataaggtgaacaactccaccttcatttagccttagagtctcaacttgttgttaaaggagcttcc |
120 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31206511 |
gaacacatatcttgaacattacaaaccgttttgttttcaaggtgaacaactccaccttcatctagccttagagtctcaacttgttgttaaa-gagcttcc |
31206413 |
T |
 |
| Q |
121 |
agagtccatgacttaacttttcaccaatagtgcctctgcttcctcgtaattttttctgcgaggcaacttgcatgaaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
31206412 |
agagtccatgacttaacttttcaccactagtgcctctgcttcctcgtaa-tttttctgtgaggcaacttgcatgaaat |
31206336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University