View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_35 (Length: 204)
Name: NF3019_1D_low_35
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 36232073 - 36232260
Alignment:
| Q |
12 |
aatagcttattaaaaacatacaaattacaatgacttaattaaaaaacttttaacgaagatagagttacttgaaatttaaaatattgtcagagtcaggact |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||| ||||||||||||||||| ||||| ||| |||| |
|
|
| T |
36232073 |
aatagcttattaaaaacatacaaattacaatgatctaattgaaaaacttttaataaagatagagttatttgaaatttaaaatattatcagaatcatgact |
36232172 |
T |
|
| Q |
112 |
aatttgaaagtggttaaagagaccaagatcaatttaacagtttactcatctttctcgatgcaataaagtaacaaagctgtttgatgag |
199 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36232173 |
aatttaaaagtggttacaaagaccaagatcaatttagcagtttactcatctttctcgatgaaataaagtaacaaagctgtttgatgag |
36232260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University