View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_36 (Length: 203)
Name: NF3019_1D_low_36
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 45893133 - 45893044
Alignment:
| Q |
1 |
tagttcattggagaatactaagatcaataggaattacagtgggggttttttgcattaattttctcctactgtaaaatttgacaatgatga |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45893133 |
tagttcattggagaatactaagatcaataggaattacagtgggggttttttgcattaattttctcctactgtaaaatttgacaatgatga |
45893044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 180
Target Start/End: Complemental strand, 45892983 - 45892954
Alignment:
| Q |
151 |
cgataggcaatgacagtgatggggctttac |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45892983 |
cgataggcaatgacagtgatggggctttac |
45892954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University