View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3019_1D_low_36 (Length: 203)

Name: NF3019_1D_low_36
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3019_1D_low_36
NF3019_1D_low_36
[»] chr3 (2 HSPs)
chr3 (1-90)||(45893044-45893133)
chr3 (151-180)||(45892954-45892983)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 45893133 - 45893044
Alignment:
1 tagttcattggagaatactaagatcaataggaattacagtgggggttttttgcattaattttctcctactgtaaaatttgacaatgatga 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45893133 tagttcattggagaatactaagatcaataggaattacagtgggggttttttgcattaattttctcctactgtaaaatttgacaatgatga 45893044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 180
Target Start/End: Complemental strand, 45892983 - 45892954
Alignment:
151 cgataggcaatgacagtgatggggctttac 180  Q
    ||||||||||||||||||||||||||||||    
45892983 cgataggcaatgacagtgatggggctttac 45892954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University