View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_1D_low_9 (Length: 334)
Name: NF3019_1D_low_9
Description: NF3019_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_1D_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 19 - 334
Target Start/End: Original strand, 45974759 - 45975074
Alignment:
| Q |
19 |
caaatatctgctttctgcgactggtttatcgacaaaaaacgacactccggtcatcatactcaccacttccaccgccgcttgtcaacctccgatgacgatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974759 |
caaatatctgctttctgcgactggtttatcgacaaaaaacgacactccggtcatcttactcaccacttccaccgccgcttgtcaacctccgatgacgatc |
45974858 |
T |
 |
| Q |
119 |
acgactattttcattctcagccagagacagccgtcaatgataccgcaatcgaccggaatttcgaccgtcaagtttcacttccgaggctatccagcgacag |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45974859 |
acgacttttttcattctcagccagagacagccgtcaatgacaccgcaattgaccggaatttcgaccgtcaagtttcacttccgaggctatcgagcgacag |
45974958 |
T |
 |
| Q |
219 |
tagctatgcagggagtttgttttccagtgacattaaagaggaaacgcagtcgtctcaagtttccaccattccagcaaccactgcgaggaggcagaaggaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974959 |
tagctatgcagggagtttgttttccagtgacattaaagaggaaacgcagtcgtctcaagtttccaccattccagcaaccactgcgaggaggcagaaggaa |
45975058 |
T |
 |
| Q |
319 |
gatgaagaaaacaaag |
334 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
45975059 |
gatgatgaaaacaaag |
45975074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University