View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3019_2D_high_2 (Length: 260)

Name: NF3019_2D_high_2
Description: NF3019_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3019_2D_high_2
NF3019_2D_high_2
[»] chr8 (1 HSPs)
chr8 (19-198)||(32957099-32957287)


Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 32957287 - 32957099
Alignment:
19 tacgttaacacttaacattaaaaaggaaagtgaggatgtggtgtgcgacgaacaatctcttattgtctctagcatggattaggaatatgaaagttttggc 118  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32957287 tacgttaacacttaacattaaaaaggaaactgaggatgtggtgtgcgacgaacaatctcttattgtctctagcatggattaggaatatgaaagttttggc 32957188  T
119 aattaatgaaggcattagattaccgag---------agagaagtgtatgtttagcattaatattgggattagagcaaggttagttgagg 198  Q
    |||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
32957187 aattaatgaaggcattagattaccgagaatgcaggtagagaagtgtatgtttagcattaatattgggattagagcaaggttaattgagg 32957099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University