View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_2D_low_5 (Length: 281)
Name: NF3019_2D_low_5
Description: NF3019_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_2D_low_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 7498307 - 7498044
Alignment:
| Q |
18 |
ctatcatcagtattggtaaacattgcataaattcttagtttcttcctttggtcatccaagttgttgtgtatatagaaaacagatccttctgtgagacttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7498307 |
ctatcatcagtattggtaaacattgcataaattcttagtttcttcctttggtcatccaagttgttgtgtatatagaaaacagatccttctgtgagacttc |
7498208 |
T |
 |
| Q |
118 |
ctacatctccttcacgtatatcgattgtgctagtaccgtcttcatttgcccaactcaattttccactgcctgaaaccccgctaagttgtatgagtataaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7498207 |
ctacatctccttcacgtatatcgattgtgctagtaccgtcttcatttgcccaactcaattttccactgcctgaaaccccgctaagttgtatgagtataaa |
7498108 |
T |
 |
| Q |
218 |
aattaatttgcttttgagataaagtgcaaaaaggatttcaataataaatggcagcataaatttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7498107 |
aattaatttgcttttgagataaagtgcaaaaaggatttcaataataaatggccgcataaatttt |
7498044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University