View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3019_2D_low_7 (Length: 260)
Name: NF3019_2D_low_7
Description: NF3019_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3019_2D_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 32957287 - 32957099
Alignment:
| Q |
19 |
tacgttaacacttaacattaaaaaggaaagtgaggatgtggtgtgcgacgaacaatctcttattgtctctagcatggattaggaatatgaaagttttggc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32957287 |
tacgttaacacttaacattaaaaaggaaactgaggatgtggtgtgcgacgaacaatctcttattgtctctagcatggattaggaatatgaaagttttggc |
32957188 |
T |
 |
| Q |
119 |
aattaatgaaggcattagattaccgag---------agagaagtgtatgtttagcattaatattgggattagagcaaggttagttgagg |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32957187 |
aattaatgaaggcattagattaccgagaatgcaggtagagaagtgtatgtttagcattaatattgggattagagcaaggttaattgagg |
32957099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University